45 {{ upvoteCount | shortNum }}
45 {{ upvoteCount | shortNum }}

Artificial Life Created!

by derekwong28
38 replies
  • OFF TOPIC
    • |
Scientists create a living organism - CNN.com

Scientists have turned inanimate chemicals into a living organism in an experiment that raises profound questions about the essence of life.

Craig Venter, the U.S. genomics pioneer, announced on Thursday that scientists at his laboratories in Maryland and California had succeeded in their 15-year project to make the world's first "synthetic cells" -- bacteria called Mycoplasma mycoides.

"We have passed through a critical psychological barrier," Dr. Venter told the FT. "It has changed my own thinking, both scientifically and philosophically, about life, and how it works."

The bacteria's genes were all constructed in the laboratory "from four bottles of chemicals on a chemical synthesizer, starting with information on a computer," he said.

The research -- published online by the journal Science -- was hailed as a landmark by many independent scientists and philosophers.

"Venter is creaking open the most profound door in humanity's history, potentially peeking into its destiny," said Julian Savulescu, ethics professor at Oxford University. "This is a step towards ... creation of living beings with capacities and natures that could never have naturally evolved."

The synthetic bacteria have 14 "watermark sequences" attached to their genome -- inert stretches of DNA added to distinguish them from their natural counterparts. They behaved and divided in lab dishes like natural bacteria.

It has changed my own thinking, both scientifically and philosophically, about life and how it works.
  • Profile picture of the author HeySal
    I am speechless at the moment.
    Signature

    Sal
    When the Roads and Paths end, learn to guide yourself through the wilderness
    Beyond the Path

    {{ DiscussionBoard.errors[2123196].message }}
  • Profile picture of the author Lawrh
    To me it's an impressive technological breakthrough. Philosophically, not so much. The instructions for life exist in every cell of every living thing. I've always considered it to be inevitable that those instructions would be put to use someday. This is the first step.

    Whether that step should be taken further is now the philosophical question.
    Signature

    “Strategy without action is a day-dream; action without strategy is a nightmare.” – Old Japanese proverb -

    {{ DiscussionBoard.errors[2123204].message }}
    • Profile picture of the author KenThompson
      Originally Posted by Lawrh View Post

      Whether that step should be taken further is now the philosophical question.
      I think nothing is gonna stop it. These guys are like kids in a candy store.
      {{ DiscussionBoard.errors[2123216].message }}
  • Profile picture of the author Kurt
    If you really think about it, this may be the biggest news of all time, yet it's just a footnote on the daily news.

    I read "they" were getting close a few years ago, but to actually do it is another thing.

    This really does bring up some great philosophical debates...For other times and places.
    Signature
    Discover the fastest and easiest ways to create your own valuable products.
    Tons of FREE Public Domain content you can use to make your own content, PLR, digital and POD products.
    {{ DiscussionBoard.errors[2123205].message }}
  • Profile picture of the author KenThompson
    Isn't that something. Raises a lot of questions and speculation.

    Now, corps will put patents on life. Something about that isn't
    resting well in me brain.

    You know they won't stop with simple bacteria. lol. No way. This
    is really pretty amazing. But did you know the four chemicals can
    be bought at your neighborhood grocery store? That's the scary
    part.
    {{ DiscussionBoard.errors[2123208].message }}
    • Profile picture of the author Lawrh
      Originally Posted by KenThompson View Post

      But did you know the four chemicals can
      be bought at your neighborhood grocery store? That's the scary
      part.
      The chemical synthesizer isn't available at Best Buy so I wouldn't worry about geeks in basements creating super bugs
      Signature

      “Strategy without action is a day-dream; action without strategy is a nightmare.” – Old Japanese proverb -

      {{ DiscussionBoard.errors[2123221].message }}
      • Profile picture of the author HeySal
        Originally Posted by Lawrh View Post

        The chemical synthesizer isn't available at Best Buy so I wouldn't worry about geeks in basements creating super bugs
        As badly as lifeforms have become to be treated now, though....how do you think our leaders will react when they know they have "disposable" life forms for every occasion. Makes me hope that the 2012 crowd is on the mark.
        Signature

        Sal
        When the Roads and Paths end, learn to guide yourself through the wilderness
        Beyond the Path

        {{ DiscussionBoard.errors[2123234].message }}
        • Profile picture of the author Lawrh
          Originally Posted by HeySal View Post

          As badly as lifeforms have become to be treated now, though....how do you think our leaders will react when they know they have "disposable" life forms for every occasion. Makes me hope that the 2012 crowd is on the mark.
          I'm more worried about those who lead our "leaders".
          Signature

          “Strategy without action is a day-dream; action without strategy is a nightmare.” – Old Japanese proverb -

          {{ DiscussionBoard.errors[2123241].message }}
          • Profile picture of the author KenThompson
            Originally Posted by Lawrh View Post

            I'm more worried about those who lead our "leaders".
            Why Lawrence, what ever do you mean by that?
            {{ DiscussionBoard.errors[2123282].message }}
      • Profile picture of the author Lawrh
        Regarding corporations patenting life, they've been trying for quite a while. The Harvard cancer mouse springs to mind. More currently, Monsanto is trying to get world patents for pigs.

        Harvard has had trouble getting it's patents, they were rejected in Canada. I don't know about elsewhere.

        Nuke Monsanto.
        Signature

        “Strategy without action is a day-dream; action without strategy is a nightmare.” – Old Japanese proverb -

        {{ DiscussionBoard.errors[2123235].message }}
        • Profile picture of the author KenThompson
          Originally Posted by Lawrh View Post

          Regarding corporations patenting life, they've been trying for quite a while. The Harvard cancer mouse springs to mind. More currently, Monsanto is trying to get world patents for pigs.

          Harvard has had trouble getting it's patents, they were rejected in Canada. I don't know about elsewhere.

          Nuke Monsanto.
          I was wondering about genetically engineered bacteria and viruses. I don't
          know, but it seems to me that whoever makes them may have a patent
          on them. ?? I don't know but would make sense. Or, maybe they just have
          a patent on the genetically altered genomes that are put into the bacteria
          and viruses.

          I read not too long ago that the mapping of the human genome has been
          completed. Pretty sure that was the news about that.

          I was also really intrigued to read that apparently we only use a very small
          portion of our genome compared to the total sum available. I like that, room
          for growth. Shelf space... sort of.
          {{ DiscussionBoard.errors[2123299].message }}
          • Profile picture of the author Lawrh
            The Human Genome Project was completed in 2003. The companies that are after patents want to own the sequences that they isolate as the causes of disease. This is to prevent any competitor from developing a treatment first. Naturally there is a lot of controversy and much effort to stop the companies from getting those patents. I don't believe any have been granted yet.

            There is a tremendous amount of opposition to any patenting of life of any kind. Hopefully they can break the patents on seeds that Monsanto and Nestle managed to get.
            Signature

            “Strategy without action is a day-dream; action without strategy is a nightmare.” – Old Japanese proverb -

            {{ DiscussionBoard.errors[2123340].message }}
            • Profile picture of the author Kay King
              I think the research should be encouraged - it will happen anyway.

              I have a problem with patenting life...including life that is man made.
              Signature
              Saving one dog will not change the world - but the world changes forever for that one dog
              ***
              Dear April: I don't want any trouble from you.
              January was long, February was iffy, March was a freaking dumpster fire.
              So sit down, be quiet, and don't touch anything.
              {{ DiscussionBoard.errors[2123352].message }}
              • Profile picture of the author KenThompson
                Originally Posted by Kay King View Post

                I think the research should be encouraged
                Don't think you have anything to worry about there. lol


                Originally Posted by Lawrh View Post

                What intrigued me was learning that we share 50% of our DNA with trees. We are products of Planet Earth and connected to virtually all life on Earth through our DNA.

                Trees, huh. That's interesting for some reason.

                And the human genome project was completed in 03? Wow... that's
                so strange. Seems like I read about that last year. But my sense of
                time is completely warped. (you have no idea) lol. Sometimes things
                are totally backwards. Something recent seems like a million years
                ago, and vice versa. There must be a reason for that. I have an idea,
                but I won't say anything. lol
                {{ DiscussionBoard.errors[2123373].message }}
          • Profile picture of the author Lawrh
            Originally Posted by KenThompson View Post

            I was also really intrigued to read that apparently we only use a very small
            portion of our genome compared to the total sum available. I like that, room
            for growth. Shelf space... sort of.
            What intrigued me was learning that we share 50% of our DNA with trees. We are products of Planet Earth and connected to virtually all life on Earth through our DNA.
            Signature

            “Strategy without action is a day-dream; action without strategy is a nightmare.” – Old Japanese proverb -

            {{ DiscussionBoard.errors[2123347].message }}
  • Profile picture of the author seasoned
    Still,

    They then transferred the completed genome into the shell of another bacterium M capricolum whose own DNA had been removed.

    The transplanted genome "booted up" the host cell and took over its biological machinery. After 30 cell divisions, there were billions of synthetic bacteria in the lab dishes -- all of them making exclusively the biological molecules associated with M mycoides.
    So they didn't actually CREATE life! They used an existing pattern and existing mechanism, and basically CHANGED it!

    They claim at the beginning that they CREATED artificial LIFE, but the article states that they basically created and used artificlal DNA. That would be like my saying I created a new computer everytime I created a new piece of software.

    Steve
    {{ DiscussionBoard.errors[2124191].message }}
    • Profile picture of the author Kelly Verge
      Originally Posted by seasoned View Post

      Still,



      So they didn't actually CREATE life! They used an existing pattern and existing mechanism, and basically CHANGED it!

      They claim at the beginning that they CREATED artificial LIFE, but the article states that they basically created and used artificlal DNA. That would be like my saying I created a new computer everytime I created a new piece of software.

      Steve
      Good point, Steve.


      Other than the scale and function, this isn't any different than an artificial heart.

      Yes, DNA is very small and hard to work with.

      Yes, modified (or created) DNA will replicate with the bacterium.

      Besides those two factors it's just a part replacement.
      Signature
      {{ DiscussionBoard.errors[2124316].message }}
    • Profile picture of the author derekwong28
      Originally Posted by seasoned View Post

      So they didn't actually CREATE life! They used an existing pattern and existing mechanism, and basically CHANGED it!
      This is essentially correct, although they did create an entriely new species of mycoplasma that would not have otherwise existed by normal evolution.

      This was mainly an academic exercise. Instead of synthesizing the whole genome, they could have replaced all the genes of another mycoplasma species bit by bit by conventional recombinant DNA technology. That would have been far faster and cheaper.

      In terms of innovation and impact, this is little compared to cloning of mammals. When "Dolly the sheep" was announced, the scientific community was completely shocked. Because cloning of mammals was thought to be scientifically impossinble whereas the technology for creating a completely synthetic baterial genome had existed for a long time.

      I have no doubt there is somethng to worry about. The presently used genetically modified crops, bateria and viruses usually only involved one to a few genes. Here, basically all the genes of an organiism have been changed. It is almost impossible how one changed gene will affect another. It is entirely possible that you could get some extremely dangerous organism produced as a result.

      Derek
      Signature

      Do not get between a wombat and a chocolate biscuit; you will regret it dearly!

      {{ DiscussionBoard.errors[2124943].message }}
      • Profile picture of the author seasoned
        Originally Posted by derekwong28 View Post

        ...

        I have no doubt there is somethng to worry about. The presently used genetically modified crops, bateria and viruses usually only involved one to a few genes. Here, basically all the genes of an organiism have been changed. It is almost impossible how one changed gene will affect another. It is entirely possible that you could get some extremely dangerous organism produced as a result.

        Derek
        HECK YEAH! That fear is NOT some imagined overreacting. It is FACT!!!!!!! People DIED because of taking "tryptophan" that was created with a genetically modified bacteria. It took MONTHS to track down, and that was from ONE source! There HAVE been cases of people dying from synergy between other relatively inert materials. That is FAR harder to track!

        Steve
        {{ DiscussionBoard.errors[2125342].message }}
  • Profile picture of the author V12
    For me, it's quite simple. I'll be impressed when someone makes something out of nothing, and not before then.

    Steve, I agree with you 100%.

    Abdul.
    {{ DiscussionBoard.errors[2125065].message }}
  • Profile picture of the author DamianK
    Wow, I find that creepy. As a species I don't think we can be trusted with that kind of power. In two hundred years from now who knows what kind of monstrosities they'll be creating. I'm sure it'll start with creatures used as slaves, then weapons of war, then they'll turn on us.....what a mess.
    {{ DiscussionBoard.errors[2125087].message }}
  • Profile picture of the author KenThompson
    Steve, you're a good cub reporter. What they did isn't creating
    something from totally nothing. Not exactly an entirely new life
    form, either. Modified and all that, sure.

    But I'm curious as to exactly why they wanted to do it. If it
    was just research to prove they could do it, or if there was a
    specific reason they had in mind - future goal.

    Have a hard time being worried about it, though.
    {{ DiscussionBoard.errors[2125499].message }}
    • Profile picture of the author Lawrh
      Originally Posted by KenThompson View Post

      But I'm curious as to exactly why they wanted to do it. If it
      was just research to prove they could do it, or if there was a
      specific reason they had in mind - future goal.

      Have a hard time being worried about it, though.
      Craig Venter has often stated that the creation of a new life form is his primary goal. One step at a time. This step is important for advancing the technology and for method development.
      Signature

      “Strategy without action is a day-dream; action without strategy is a nightmare.” – Old Japanese proverb -

      {{ DiscussionBoard.errors[2125544].message }}
    • Profile picture of the author seasoned
      Originally Posted by KenThompson View Post

      Steve, you're a good cub reporter.
      WOW, is that a complisult?

      But I'm curious as to exactly why they wanted to do it. If it
      was just research to prove they could do it, or if there was a
      specific reason they had in mind - future goal.
      They kind of IMPLY it might be to make a better fuel source. ALSO, BP was mentioned, so it might be something to try and detract from the spill.

      Steve
      {{ DiscussionBoard.errors[2125547].message }}
  • Profile picture of the author lcombs
    There are things that man was meant to leave alone.
    This is one.

    Mankind, ( I love to take every opportunity to be politically incorrect), has a history of abuse.

    Let's see...

    Iran and North Korea with nukes.

    Genetic engineering is like Congress screwing with the Constitution.
    It will do more harm than good.

    If you've never seen "The Boys From Brazil" watch it.
    (Kind of ironic considering Brazil's recent dealings with Iran).
    Signature
    https://www.facebook.com/pages/Fresh...55326481208883
    {{ DiscussionBoard.errors[2126726].message }}
  • Profile picture of the author Zentech
    Pretty amazing. Venter is always at the forefront of this kind of thing. A bit scary, too, especially since this is a guy who wants to patent the human genome.
    Signature
    * Stupid Offer: Killer Sales Letters ***$897*** Just For Warriors. Ethical Clients & Legit Products Only. *
    {{ DiscussionBoard.errors[2126736].message }}
  • Profile picture of the author Don Schenk
    My wife's comment about the article...

    "It said that the researchers made the bacterium by “stitching together” shorter strands of DNA into one large one. I wonder where the shorter strands came from? And OMG – I hope they are careful about what they create, especially if they are creating microbes – hope they don’t create anything that they can’t kill if they need to. Who ever thought Frankenstein would turn out to be a germ?"

    :-Don
    Signature

    Studies prove happier people have massively more success. It has worked for me. Use this one trick too... Click Here

    Total Competition Stomper - Simply the most powerful tactic your IM or Offline business will ever use... See it here!
    {{ DiscussionBoard.errors[2128695].message }}
    • Profile picture of the author derekwong28
      Originally Posted by Don Schenk View Post

      My wife's comment about the article...

      "It said that the researchers made the bacterium by “stitching together” shorter strands of DNA into one large one. I wonder where the shorter strands came from?
      I don't like resusicitated old threads but I cannot resist the temptation here. I want to prove to myself that I still know something of my previous profession.

      The shorter strands are made by a machine which is called an oligonucleotide synthesizer.



      All DNA is made from 4 nucleotides:

      A = Adenine
      T = Thymine
      C = Cytosine
      G = Guanine

      If you look at the machine, you will see a few bottles at the front. Let's for simplicity's sake, one of these bottles contain A, and the others T, C, and G.

      The operator then inputs the desired DNA sequnce into the machine e.g.

      ATTCCCGGGAGCTACGGCATTTACGAAACCGGCA

      The machine then takes the desired nucleotide from the correct bottle and stick it onto the end of the growing DNA strand. You can only make up to a hundred or so because the concentration gets less and less. Basically, you will end up with thousands of these oligonucleotides which you then have to stick to gather to form a single massive DNA molecule of a million nucleotides or more.

      I hope it makes sense. I am probably grossly simplying things here and I am not up to date with the most current technology.

      Derek
      Signature

      Do not get between a wombat and a chocolate biscuit; you will regret it dearly!

      {{ DiscussionBoard.errors[2951596].message }}
  • Profile picture of the author Patrician
    Very interesting and the implications of course could be chilling.

    Derek. I have a request. I wish you would remove the 'We are God' statement.

    It is extremely offensive to me and the possible ramifications of this fallacy are more than chilling.

    We are not supposed to discuss religion here - since I can't, then you can't (shouldn't be able to). LOL.

    I realize I am starting an argument. I am sorry for that and hope that I won't get attacked and the thread shut down or my post deleted.

    I think that what I am saying is only fair. If a statement is made then in all fairness it should be allowed to be refuted. Since this isn't possible without a major civil uprising, please remove that statement.

    We are NOT God.

    This message is for Derek and doesn't need any comments from anyone else please.
    You are not going to change my mind and I probably can't change yours so let's just agree to disagree.
    Signature

    Patricia Brucoli
    Plug-In Profit Site Helpdesk

    {{ DiscussionBoard.errors[2129353].message }}
  • Profile picture of the author FostinWD
    is this for real? they must be using something that already exists to create "new life" like they claim.. arent they?
    Signature

    If you're going to tell members to check your signature, this is what they'll see.

    {{ DiscussionBoard.errors[2129433].message }}
  • Profile picture of the author Pauline60
    How on earth can any company,corporation or individual patent 'life' in any form whatsoever? I would laugh but I can't, its such an awful thought that anyone should think that they could possibly have the right to do this.

    These people who work in laboratories are very clever and do some wonderful things which benefit mankind but this is not one of those things. They may be able to stitch genes together or whatever but they do not create life. The miracle of life has already been created and carrries on in the world through the power of nature.

    Most days I believe in God. (being a good Catholic girl,whatever that is.) On the days that I struggle with God I believe in nature or some greater force that we are all part of. This is what creates life, not some scientist in a lab, they are just messing about with what has already exists.

    I have given birth to four children and I never felt at any of those events that I had created life - I was just in awe of how God or nature had given my body the ability to do this. That was quite enough for me.

    My personal view, as old fashioned as it may sound, is that they should leave this sort of thing alone and concentrate their considerable abilities on something which will genuinely benefit the world, like preserving existing life.

    Pauline
    {{ DiscussionBoard.errors[2129688].message }}
  • Profile picture of the author Mohit Anand
    As good as this achievement may sound, it may turn out to be worse than we thought. If God is within us, evil is there too. 100 years back, who thought that nuclear research may lead to atomic bombs? This can advance us to develop sophisticated bio-chemical weapons or something else we can't imagine now. If creation of life can become easier, the death can become more torturous for the victims.
    Signature
    {{ DiscussionBoard.errors[2129743].message }}
  • Profile picture of the author derekwong28
    Pat, I am very sorry that the IMish exaggerated title upsetted you and I have removed it.

    I just want to clarify that no new artificial lifeform had been created but just a syntheitically modified organism. Only very minor variations in the genes are allowed for the gene to continue to work. Therefore the "new" organism is probably going to be very similar to other mycoplasma.

    This is really not much different to the genetically modified foods that we are eating, except that the number of modified genes are greater.

    Derek
    Signature

    Do not get between a wombat and a chocolate biscuit; you will regret it dearly!

    {{ DiscussionBoard.errors[2131245].message }}
  • Profile picture of the author SEOExpert104
    WOW, the world has gone crazy! What's next? People will start building their own planet instead of houses -_-
    {{ DiscussionBoard.errors[2131405].message }}
  • Profile picture of the author Patrician
    Thank you, Derek. Very kind of you.

    I am glad you have explained further as well.

    We are always pre-creating the next horror movie in our minds with each news story.

    Lots of material, that is for sure.

    Take care.

    Pat
    Signature

    Patricia Brucoli
    Plug-In Profit Site Helpdesk

    {{ DiscussionBoard.errors[2131927].message }}
    • Profile picture of the author Hesaidblissfully
      From reading the article, they created an artificial GENOME from scratch and inserted inside of the "shell" of a bacteria, which means they've created a form of artificial life that doesn't occur in nature. That being said, scientists have been using genetic engineering techniques to create plants and animals that don't occur in nature for decades now. And we've been using selective breeding for thousands of years to create new breeds of animals, which could be considered a very slow and primitive form of genetic engineering.

      This project was more of a "proof of concept" experiment. It'll be interesting to see if any beneficial technology develops from it, although I think the article mentioned the potential for being able to create new forms of bacteria that could be used to clean up toxins in the environment.

      I'm generally in favor of research into biotechnology because of the potential benefits to mankind, but like any kind of technology it's a double edged sword. The results of biotechnology research could destroy or save many millions of lives. The questions we should be asking ourselves are how we can navigate down this path of research in as safe a way as possible so that we maximize the benefits while minimizing the risks.
      {{ DiscussionBoard.errors[2132486].message }}
      • Profile picture of the author Kurt
        Originally Posted by Don Schenk View Post

        My wife's comment about the article...

        "It said that the researchers made the bacterium by “stitching together” shorter strands of DNA into one large one. I wonder where the shorter strands came from? And OMG – I hope they are careful about what they create, especially if they are creating microbes – hope they don’t create anything that they can’t kill if they need to. Who ever thought Frankenstein would turn out to be a germ?"

        :-Don
        Originally Posted by Hesaidblissfully View Post

        I'm generally in favor of research into biotechnology because of the potential benefits to mankind, but like any kind of technology it's a double edged sword. The results of biotechnology research could destroy or save many millions of lives. The questions we should be asking ourselves are how we can navigate down this path of research in as safe a way as possible so that we maximize the benefits while minimizing the risks.
        And to me, this is the greatest debate of this new century...The power of DNA and what to do about it.

        On one hand we could create a bacteria that wipes us out, or intentionally make one that only kills people of a certain genetic background (aka race). Think if the next Hitler or Stalin has a "genetic bomb".

        On the other hand, maybe we could create a bacteria that eats oil then dies...Or splice wheat and bamboo, so wheat could grow a foot a day. Or maybe take the DNA from a salamander and if someone loses a limb they can grow one back...It's even possible that someday we have Kim grow another kidney.

        DNA could give us "eternal life", or a very very long life. Most DNA and aging experts say aging is really just a genetic disease and we're programed to die...It may be possible to turn off this switch (gene).

        I'm not starting a debate over good and evil, only stating facts that we have some very tough decisions to make.
        Signature
        Discover the fastest and easiest ways to create your own valuable products.
        Tons of FREE Public Domain content you can use to make your own content, PLR, digital and POD products.
        {{ DiscussionBoard.errors[2132613].message }}
  • Profile picture of the author Rick B
    While there are dangers to this research just like there has been in the past to many other new developments, there is also huge potential for benefits.

    I saw a show the other day about scientists who have found a virus that prefers to attack cancer cells over healthy cells. Not by much, but a little. This new research could allow scientists to create a new virus that ONLY destroys cancerous cells and no others. Sound usefull?

    Or a plant that converts carbon dioxide to oxygen 50 times faster than any other plant. Bye Bye global warming!

    Many drugs we use can cure disease but have horrible side effects. What about bacteria that alter the chemical composition of drugs to eliminate the side effects or make the drug more effective in fighting the disease.

    What about creating a vegetable that tastes exactly like a ribeye steak. We could stop slaughtering animals and still enjoy the flavors we love. Or a vegetable that grows in a much shorter season and requires no pesticides because it's highly resistant to pests? Cheap, healthy, tasty food sounds like a good idea to me.

    Yes; once you can create life with the characteristics you desire, all kinds of things become possible, not just bad things.
    {{ DiscussionBoard.errors[2953190].message }}

Trending Topics